Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells


Download 20.4 Kb.
NameGemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells
A typeDocumentation
Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells
Arianna Bonomia, Valeria Sordib, Erica Dugnanib, Valentina Ceseranic, Marta Dossenac, Valentina Coccèa, Loredana Cavicchinia, Emilio Ciusanid, Gianpietro Bondiolottie, Giovanna Piovanif, Luisa Pascuccig, Francesca Sistoa, Giulio Alessandric, Lorenzo Piemontib, Eugenio Paratic, Augusto Pessinaa
SUPPLEMENTARY INFORMATION
MATERIALS AND METHODS

MSCs characterization

BM-MSCs were tested for their capacity to differentiate into osteocytes, condrocyte and adipocytes using the methods suggested by Pittenger et al. [33] with some modifications [19]. The cells, plated at density of 400 cells/cm2, were cultured with specific differentiation media for 14 days (osteogenic differentiation), 24 days (chondrocytic differentiation) or 10 days (adipogenic differentiation), then fixed by cooled methanol (osteogenic differentiation) or formalin solution 4% (chondrocytic and adipogenic differentiation) and processed, respectively, for alkaline phosphatase staining, immunohystochemistry for aggrecan and oil red O staining. The ability of pMSCs to differentiate to adipocytes, osteoblasts and chondroblasts was assessed by a Cambrex MSCs differentiation BulletKit according to the manufacturer’s instructions. Adipogenic, osteogenic and chondrogenic differentiation was detected by Oil Red O, Alizarin Red S and Alcian Blue staining (Sigma-Aldrich, St. Louis, MO, USA).

BM- MSCs characterization was performed by flow cytometry (FacsVantage SE, Becton Dickinson, USA) using the following fluorochrome-conjugated mouse anti-human antibodies: CD13-PE (clone WM-15), CD14-PE (clone M5E2), CD31-PE (clone WM59), CD33-FITC (clone HIM3-4), CD34-FITC (clone 8G12), CD45-Cy5.5 (clone 2D1), CD73-PE (clone AD2), CD80-FITC (clone L307.4), (Becton Dickinson, USA); CD90-FITC (clone F15-42-1) and CD105-PE (clone SN6) (Serotec, Germany); HLA-DR-APC (clone TU36) from Caltag Laboratories (Burlingame, CA, USA); HLA B55 (clone 4i112) from abcam (Cambridge, UK). For CD34 and CD105 a minimum of 100,000 events per sample were acquired; for the other markers, 10,000 events per sample were acquired. The analysis was performed using specific software (CellQuest Pro, Becton Dickinson). Data reported refer to at least two independent experiments.

The CD characterization of pMSCs was performed by FACSCalibur flow cytometer using Cell Quest software (BD Biosciences, San Jose, CA, USA). All the CD markers evaluated for BM-MSCs but CD33 and CD80 were analysed; furthermore, pMSCs were also stained for CD19-FITC (mouse anti-human, clone HIB19, BD Bioscience).

Evaluation of Population Doubling Time (PDT) in MSCsGCB

MSCs, before and after GCB treatment, were trypsinized, seeded in 24-well plate (15,000 cells/well) in 1 ml/well of culture medium and incubated for 144 hours at 37°C, 5% CO2. At the end of the incubation time, PDT was calculated as follows: PDT (hours) = (t1-t0) / (3.32* (Log Nt1-Log Nt0)). Nt0 is the number of cells seeded at the starting time (t0), Nt1 is the number of cells recovered at time t1 (144h) [34].

HPLC dosage of GCB in MSCsGCB-CM and LYS

The standard GCB curve was obtained by adding 5 µl of four GCB solutions (containing 3, 10, 30 and 100 ng of the drug) to 5 ml disposable tubes (in duplicate) containing 500 µl of medium/lysate from control MSCs cultures (no internal standard was used). 500 µl of each sample (MSCsGCB-CM or LYS) was pipetted into 5 ml disposable tube (in duplicate). After the addiction of 500 µl/tube of calcium- and magnesium-free phosphate buffered saline (PBS), the samples were loaded on Oasis SPE cartridges (Waters Corporation, Milford, MA, USA) as described by Yan et al. [35]. The eluate was transferred to a fresh tube and evaporated to dryness under vacuum (Rotavapor R 110, Buchi Labortechnick AG, Switzerland). The samples were reconstituted with 60 µl of water, and carried out for 5 min in 37°C water bath, filtered through 0.2 μm nylon filters (Phenomenex, Phenex-NY 4 mm), then transferred to glass autosampler vials. An aliquot of 30 μl was injected in a HPLC system, consisted of an Agilent 1100 Series (Agilent Technologies, Inc. Santa Clara, CA) equipped with Ascentis Express C18 column, 4.6x150 mm, 2.7 μm particle sizes (Supelco Analytical). The analysis was operated at 40°C, in isocratic mode using as mobile phase a solution of 50 mM sodium dihydrogen phosphate monohydrate, 0.42 mM of octansulfonic acid, 4 ml/L of 1N hydrochloridric acid and acetonitrile (94:6 v/v) delivered at rate of 0.5 ml/min. The eluent was monitoring using UV-Visible DAD detector at 275 nm. The retention time of GCB was 7.8 min, the limit of quantitation (LOQ) was 5 ng/ml.

Preparing of lysates from MSCsGCB

After the collection of MSCsGCB-CM, the cells were trypsinized, resuspended in bidistilled water at the concentration of 106cells/ml and then frozen/thawed four times at -20°C. After centrifugation at 2,500 g for 15 minutes and the discard of cell debris, the lysates (MSCsGCB-LYS) were aliquoted and stored at -70°C.

Quantitative real-time PCR for Concentrative Nucleoside Transporter-1 (hCNT-1)

The collected cell pellets were lysed and extracted by Trizol (Life technologies, CA, US) following the manufacturer’s instructions. The total RNA yield was determined by absorbance at 260 nm, and RNA quality was analyzed using agarose gel. Qualified total RNA was further purified using the RNeasy micro kit (QIAGEN, GmBH, Germany) and genomic contamination was removed by RNase-Free DNase Set (QIAGEN).

Total RNA (1 μg) treated with DNase was used in a 50 μL reverse transcriptase reaction to synthesize cDNA. Briefly, RNA was denatured with 1 mM deoxyribonucleotide triphosphate (dNTP) and 5 ng/μL random hexamers at 65°C for 5 minutes. After the addition of 5x First Strand buffer (20 mM Tris-HCl, pH=8.4) and 0,1 M DTT, RNaseOUT (Recombinant Ribonuclease Inhibitor, 40 U; Life Technologies) and M-MLV RT (200U), the reaction mixture was incubated at 37°C for 60 minutes, at 95°C for 5 minutes, 10 minutes on ice.

qRT-PCR was performed using SYBR Green (Applied Biosystems). The qRT-PCR was run on a real-time PCR system (Applied Biosystems).

The following primers (100 pM/µl) were designed using Primer3 software: hCNT-1, forward: CAGGGCACCCACAGTGATAG, reverse: CACCCTTCCTCCATTGGTCC; housekeeping gene (hGAPDH) forward: GTCGGAGTCAACGGATT, reverse: AAGCTTCCCGTTCTCAG.

The data were obtained by using Sequence Detector software (SDS version 1.3.1; 7500 REAL-TIME PCR Applied Biosystems) and quantified using a standard curve method. Experiments were typically performed three times in triplicate, and each gene expression level was taken as the average of three independent experiments. The single expression level of target gene normalized by a housekeeping gene (raw target gene expression level divided by raw housekeeping gene expression level) was used for statistical analysis. Fold changes in gene expression were calculated using the ΔΔCt method.

Double priming of BM-MSCs with PTX and GCB

To evaluate if the combination of PTX and GCB was more toxic than the use of a single drug, a cytotoxic assay was performed as above described by incubating BM-MSCs with increasing concentration of the two drugs at the same mixing ratio (1:1).

Then, sub-confluent cultures of BM-MSCs were primed with PTX 1,000 ng/ml or GCB 1,000 ng/ml or with a combination of PTX 1,000 ng/ml + GCB 1,000 ng/ml. The collection of conditioned media after 48 hours of sub-culture was performed as above described and all the CM were tested for their anti-proliferative activity against CFPAC-1.

Transmission electron microscopy

Transmission electron microscopy (TEM) was performed on pMSCs and BM-MSCs loaded and not with GMB and on rosettes obtained from co-cultures of CFPAC-1-pMSCs and of CFPAC-1-BM-MSCs preceded and not by GCB loading. Cells and rosettes were washed with 0.1 mol/l pH 7.2 phosphate buffer (PB) and then centrifuged at 600 g for 10 min before fixation in 2.5% phosphate buffered glutaraldehyde for 1 h at room temperature. After washing in PB, the pellets were post-fixed in phosphate buffered Osmium tetroxide (1%) for 1 h at room temperature, dehydrated in graded ethanol up to absolute, cleared in propylene oxide, pre-infiltrated and embedded in epoxy resin (Epon 812). Ultrathin sections (90 nm) were mounted on 200-mesh copper grids, stained with uranyl acetate for 30 min, and examined with a Philips EM 208 transmission electron microscope equipped with a DXM 1200 digital camera (CUME–Laboratory of Electron Microscopy, University of Perugia, Italy).

RESULTS

Confirmation of the presence of GCB in BM-MSCsGCB-CM and LYS by HPLC analysis

The presence of GCB in conditioned media and lysates was confirmed by HPLC analysis. The Figure S3 shows the HPLC chromatograms obtained for BM-MSCs. No peak with the retention time of GCB was present in the conditioned medium of control MSCs (BM-MSC-CM) (Figure S3a) neither in their cell lysate (BM-MSCs-LYS) (Figure S3d). In both the BM-MSCsGCB-CM and BM-MSCsGCB-LYS (Figures S3b and S3e) a peak of identical retention time of GCB was eluted. This peak corresponds exactly to that found in the standard solution of GCB (80 ng/ml) prepared in BM-MSCs-CM (Figure S3c) and BM-MSCs-LYS (Figure S3e). The same result has been found for pMSCs.

Evaluation of GCB internalized but not released by MSCsGCB

In order to evaluate the amount of GCB incorporated by MSCs but not released in the CM, MSCs were trypsinized and lysed after their collection. The lysates (MSCsGCB-LYS) were then tested against CFPAC-1 to assess their anti-proliferative activity. As shown in Figure S4, some GCB was not released by MSCs in the culture medium after sub-culture. MSCsGCB-LYS showed an anti-proliferative activity on CFPAC-1 very similar to MSCsGCB-CM suggesting that the amount of GCB not released (expressed as percentage of total activity found) ranged from 26.71±15.07 % (BM-MSCs) to 33.33±22.22 % (pMSCs).

Priming of BM-MSCs with combined GCB and PTX

BM-MSCs showed to be resistant to the combined treatment with GCB and PTX. Their viability was major than 90% in the presence of 10,000 ng/ml of PTX+10,000 ng/ml of GCB (Figure S6a). By considering this result, we primed sub-confluent cultures of BM-MSCs with 1,000 ng/ml PTX + 1,000 ng/ml GCB. BM-MSCs were able to uptake both the drugs as demonstrated by the anti-proliferation assay performed against CFPAC-1: indeed, the CM collected from BM-MSCs primed with the two drugs (BM-MSCsPTXGCB-CM) was more active in inhibiting tumor cell proliferation than CM collected from BM-MSCs primed with one drug only (BM-MSCsPTX-CM and BM-MSCsGCB-CM) (Figure S6b). This enhanced anti-proliferation activity is well clear in the Figure S6c that shows the inhibitory activity percent of each CM expressed as the reciprocal of V50 (1/V50*100). Certainly, further investigations need to be carried out to better understand the mechanism (additive or synergistic) at the base of this increased inhibitory activity. The information could be noteworthy for a future in vivo translation of this therapeutic approach.

MSCs secretome evaluation

The pattern of 48 chemokine/cytokines/growth factors released into the conditioned media by MSCs from pancreas and bone marrow, both control and GCB primed, has been evaluated. The ratios between the amount found in control sample (MSCs-CM) and the amount detected in MSCsGCB-CM were shown in Figure S7. We observed that the basal secretion patterns of BM- and pMSCs were very similar with a standard secretion of IL6, VEGF and SCGF. A higher expression of IL8, GROa, MCP1 and HGF was observed in pMSCs. The 24-hour priming with GCB produced a little increase (2.27-4.36 folds) of secretion of IL6, VEGF and SCGF in BM-MSCs. No significant modulation (1.33-2.95 fold increase) was observed in pMSCs. In BM-MSCs the IL12p40 that was almost undetectable (0.8 pg/ml) became detectable (173 pg/ml) with an apparent fold increase of about 200 times.

TEM analysis of MSCs and rosette MSCs-CFPAC-1

Control pMSCs were quite homogeneous in size. They showed a characteristic polarized morphology with a “villous” front, rich in pseudopodal evaginations. Nucleus was euchromatic, irregularly profiled and contained multiple nucleoli. Cytoplasm displayed an extensive synthetic apparatus (rough endoplasmic reticulum, free ribosomes and Golgi complex) and a considerable number of elements of the endo-lysosomal apparatus. pMSCsGCB showed no morphological differences when compared to control cells. Their ultrastructural features, in fact, were preserved both in the nuclear and in the cytoplasmic compartment.

BM-MSCs were characterized by a wide, often eccentric nucleus with multiple nucleoli and finely dispersed chromatin. The cytoplasm was rich in ribosomes and showed a rough endoplasmic reticulum with linear and dilated cisternae, extensive Golgi complex and endo-lysosomal components. GMB loading didn’t determine alterations in their ultrastructural morphology, except for a slight increase in lysosomes and endo-lysosmes. The treatment with GMB, finally, didn’t affect the ability of both cytotypes to produce extracellular membrane vesicles (Figure S8, pictures a-d).

Rosettes obtained by co-culture of CFPAC-1 and pMSCs primed or not with GCB were analysed by TEM. The same was done for rosettes derived from co-cultivation of CFPAC-1 and BM-MSCs, loaded or not with GMB.

As shown in Figure S8 (pictures e-h), pMSCsGCB-CFPAC-1 and BM-MSCsGCB-CFPAC-1 were characterized by an evident damage of tumor cells ranging from vacuolation to a severe alteration of ultrastructure, with cellular degeneration and death. The most significant injuries were observed in pMSCsGCB-CFPAC-1 rosettes. In both models, specific interactions (i.e. structural or functional junctions) between MSCs and CFPAC-1 were never observed. However, CFPAC-1 appeared often enclosed by MSCs expansions.

REFERENCES

  1. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999; 284: 143-47.

  2. Hayflick L. Tissue Culture Methods and Applications. New York: Academic Press; 1973.

  3. Xu Y, Keith B, Grem JL. Measurement of the anticancer agent gemcitabine and its deaminated metabolite at low concentrations in human plasma by liquid chromatography-mass spectrometry. Journal of Chromatography B 2004; 802: 263–70.



Share in:

Related:

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconIdentification of new genes associated to senescent and tumorigenic...

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconSupplementary information for Targeting Androgen Receptor in Bone...

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconManual for as cells

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconThe structure and function of cells and organisms

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconDescription of Fuel Cells and Hydrogen 38

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconIsolation of gnc and t-cells and dna extraction

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconCharging: us battery, 17 us-2200 batteries, 51 cells

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconCell lines and germinal center b cells

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconMehta et al., Gene and mirna transcriptional Signatures of Angiotensin II in Endothelial Cells

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconAbstracts collected regarding genes up or down regulated (2 fold...

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconSupplementary Table Highly diverse stimuli induce chemokine expression in blood and tissue cells

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconMonolithic Chip for High-throughput Blood Cell Depletion to Sort Rare Circulating Tumor Cells

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconSupplementary Figure Genes with high expression divergence between...

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconFigure cell surface marker expression and morphology of iE2 cells...

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconSupplementary Information: Nuclear Lamins are Not Required for Lamina...

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconAbstract The regulation of European air traffic, as currently done...

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconCrude Cell Pellets: 10 cell factories of gmp qualified hek293 cells...

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconFigure S1: The role of Smad and the mek/erk pathways in short (3...

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconAbstract The purpose of this study was to determine whether a proprietary...

Gemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro proliferation of human pancreatic carcinoma cells iconF prana, Connective Tissue Ring Frequencies 26-38 igure 1 – Healing...




manual


When copying material provide a link © 2017
contacts
manual-guide.com
search