Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture


Download 68.26 Kb.
NameFigure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture
A typeDocumentation
manual-guide.com > manual > Documentation


Figure S1. Retroviral transduction efficiency of primary CB-expanded erythroblasts. CB MNCs were expanded in erythroblast expansion condition for 19 days before retroviral transduction. In this figure, GFP-expressing retroviruses used as a control in Figure 2 were transduced into day 19 primary erythroblasts. Two days later, bright field (a) and fluorescence images (b) were taken to evaluate the transduction efficiency (~30%).



Figure S2. Cell surface marker expression and morphology of iE2 cells at additional days of expansion culture. (a) iE2 cells maintain immature erythroblast phenotype throughout the expansion culture. (b) iE2 cells do not express other myeloid or lymphoid cell surface markers throughout the expansion culture. (c) iE2 cells still have typical erythroblast morphology at day 333 of ex vivo expansion. Scale bar: 10µm.



Figure S3. Characterization of additional iE cell lines (a) Cell surface markers and intracellular hemoglobin expression of iE3 cells (derived from CB erythroblasts with three genetic factors: Sox2, c-Myc and p53shRNA) at day 83 of expansion culture. (b) Wright-Giemsa and benzidine staining of cytospin slide prepared from iE3 cells at day 140 of expansion culture. Scale bar: 10µm. (c) G-banding of iE3 cells at day 144 of expansion showed normal karyotype. (d) Growth curve of iE5 (derived from a different CB donor). S: Sox2; K: Klf4; M: c-Myc; P: p53shRNA. (e) Cell surface marker expression on iE5 cells at day 80 of expansion.



Figure S4. Growth factor elimination experiments started at day 271 of iE2 expansion culture showed that the continuous survival and proliferation of iE2 cells is dependent on the combinational act of SCF (S), Epo (E) and Dexamethasone (D).



Figure S5. Southern blot analysis for detecting transgene integrations in iE cells after retrovirus-mediated stable gene transfer. Because mouse cDNA of c-Myc and Sox 2 was used as transgene in the retroviral vectors, we made probes using mouse c-Myc (a) or Sox2 cDNA as a template. Genomic DNA from iE2, iE3 and their parental pCBE19 cells (from the same donor) was digested with (a) BamHI (for the c-Myc probing) or (b) HindIII (for the Sox2 probing) and hybridized with the respective cDNA probes as described2. The presence of the (mouse) c-Myc cDNA was detected in iE2 (at different passages, day 63 and 149) and iE3, but negative in the parental pCBE19 cells (a). The detection of the Sox2 cDNA (b) in iE2 and iE3 cells showed similar results, although the Sox2 probe also detected endogenous human genes (Sox2 or other related Sox genes) as evident in the lane using the parental pCBE19 cells. Transgene-specific signals (marked by *) were common in the two samples of the iE2 cells, but different those detected in the iE3 cells. Therefore, the iE2 and iE3 appear to be clonal (or near-clonal) cell populations, containing integrated cDNA at unique chromosomal locations in each cell line.

Figure S6. Western blot analysis of p53 protein levels. (a) Western blotting using a specific monoclonal antibody recognizing the p53 protein. After stripping, the blot was reprobed by a specific antibody recognizing the housekeeping protein GAPDH. The signals are visualized using enhanced chemiluminescence (ECL). (b) Relative densitometry quantitation of p53 protein level compared to GAPDH protein level for the p53 protein bands in (a). The relative value is normalized to pCBE19 value.



Figure S7. Gene Expression analysis of the selected genes related to pluripotent stem cells (PSC) self-renewal (a), or hematopoietic stem/progenitor cell (HSC) self-renewal (b), using the same microarray data set among different cell types (Figure 4g). The selection of genes in each group was based on previous literatures (ref. 22, 29 in main text) and the relative levels of gene expression were based on all the genes included in the microarray. See methods and Figure 4g for more details.



Figure S8. qRT-PCR of α like (a) and β like (b) hemoglobin gene expression of primary culture-expanded erythroblasts (pCBE19), iE2 cells and terminally differentiated iE2 cells. The value is normalized to GAPDH expression.



Figure S9. Terminal differentiation (maturation) culture of primary CB culture-expanded erythroblasts (day 19 of expansion from CB MNCs). (a) Cell number expansion during the terminal differentiation culture of primary CB culture-expanded erythroblasts. (b) Bright field images of Wright-Giemsa staining and Benzidine staining of cytospin slides prepared from primary CB culture-expanded erythroblast cell differentiation culture at different time points. Red arrows mark enucleated erythrocytes. (c) Multichannel immunofluorescence microscopy images of primary CB culture-expanded erythroblast cell differentiation culture at different time points. Red: DRAQ5 (stains for DNA). Green: CD235a-FITC. (d) Flow cytometry analysis of CD235a (Glycophorin A) and DRAQ5 (a cell permeable DNA fluorescence dye) staining of terminal differentiation culture cells from primary CB culture-expanded erythroblasts. Enucleated erythrocytes are shown in the rectangular gates as CD235a+DRAQ5- cells. Scale bar: 10µm.



Figure S10. Analysis of human Duffy blood group antigen (hDARC) expression on (a) iE2 (d335) and (b) their day 16 differentiated cell surface detected by FACS.



Figure S11. Terminal differentiation (maturation) culture of iE3 cells (at day 190 of expansion). (a) Cell number expansion during the terminal differentiation culture of iE3 cells. (b) FACS analysis at day 12 of iE3(d190) cells after induction of terminal differentiation. Enucleated erythrocytes were detected at 10.4% as CD235a+DRAQ5- cells. (c) Bright field images of Wright-Giemsa staining of iE3(d190) cells at different time points of differentiation. Red arrows mark enucleated erythrocytes. Scale bar: 10μm



Figure S12. Human erythroleukemia cell line TF-1 cells do not terminally differentiate in terminal differentiation (maturation) condition. (a) Cell surface marker phenotype of TF-1 cells that have been cultured in suspension liquid culture supplemented with Epo for 8 days. (b) Cell number expansion of TF-1(Epo_d8) under the same condition with OP9 co-culture for erythroid terminal differentiation. Cells continued proliferation after 16 days. (c) FACS analysis of TF-1(Epo_d8) cells 16 days after induction of terminal maturation (as iE2 cells). No significant numbers of enucleated cells (DRAQ5-) were found. (d) Fluorescence microscopy images of day 16 of TF-1(Epo_d8) cells after induction of terminal differentiation. Red: DRAQ5; Green: CD235a-FITC. Scale bar: 10μm.

Table S1. Summary of iE cell lines generated from two CB donors.

iE cell line

CB donor

Genetic factors

Phenotypes

Growth potential

Karyotype

Terminal differentiation potential

iE1

GBCB1

Oct4, Sox2, c-Myc, p53shRNA,Klf4

Unstable;
Before day 80: CD235a+CD36+CD45+
After day 100: CD34+CD133+CD45-
(adherent)

>200 days

Normal at day 46, 101

Not determined; Because the iE1 cell changed to CD45- adherent cells, we didn’t test its terminal erythroid differentiation potential)

iE2

GBCB1

Sox2, c-Myc, p53shRNA,Klf4

CD235a+CD36+CD45+

>365 days

Normal at day 109, 159, 275

Good (>30% enucleation, >70% hemoglobinization)

iE3

GBCB1

Sox2, c-Myc, p53shRNA

CD235a+CD36+CD45+

>200 days

Normal at day 40, 144

Fair (~10% enucleation, ~50% hemoglobinization)

iE4

GBCB1

Sox2, c-Myc, p53shRNA,Klf4

CD235a+CD36+CD45(low)

>200 days

To be determined

Poor (cells died during differentiation)

iE5

CBC080811A

Sox2, c-Myc, p53shRNA

CD235a+CD36+CD45(low)

>100 days

To be determined

To be determined

Table S2. Selected genes with down-regulated expression in immortalized erythroblasts (iE2) compared to cultured CB primary erythroblasts (pCBE19)

Gene

Description

Fold decrease of mRNA level (iE2 to pCBE19) (n=2)

HBZ

hemoglobin, zeta

108.67±70.27

ERAF

erythroid associated factor (Alpha-hemoglobin-stabilizing protein)

68.31±22.04

HBB

hemoglobin, beta

56.32±11.62

HBA1

hemoglobin, alpha 1

10.00±6.74

BCL11A

B-cell CLL/lymphoma 11A (zinc finger protein)

5.98±0.32

TP53

Tumor protein p53

2.36±0.35

Table S3. Selected genes with up-regulated expression in immortalized erythroblasts (iE2) compared to cultured CB primary erythroblasts (pCBE19)

Gene

Description

Fold increase of mRNA level (iE2 to pCBE19) (n=2)

SOX2

SRY (sex determining region Y)-box 2

34.67±4.63

BMPR1A

bone morphogenetic protein receptor, type IA

25.86±0.33

LIN28B

lin-28 homolog B

8.31±0.35

FGFR1

fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) (FGFR1), transcript variant 1

7.22±1.83

SOX6

SRY (sex determining region Y)-box 6, transcript variant 1

4.40±0.08

KLF12

Kruppel-like factor 12 (KLF12)

3.95±0.74

SOX4

SRY (sex determining region Y)-box 4

3.82±0.47

HES1

hairy and enhancer of split 1

3.50±0.64

MYBL1

v-myb myeloblastosis viral oncogene homolog (avian)-like 1

3.16±0.94

SOX21

SRY (sex determining region Y)-box 21 (SOX21)

2.45±0.01

MYB

v-myb myeloblastosis viral oncogene homolog (avian)

1.61±0.17

Table S4. Primer sequences and PCR parameters used for RT-PCR of mouse and human genes

Gene Name

Forward Primer (5’ – 3’)

Reverse Primer (5’ – 3’)

Amplicon Size (bp)

Annealing Temperature

(°C)

Number of PCR Cycles

Mouse Oct4

CTGAGGGCCAGGCAGGAGCACGAG

CTGTAGGGAGGGCTTCGGGCACTT

485

69

40

Mouse Sox2

GGTTACCTCTTCCTCCCACTCCAG

TCACATGTGCGACAGGGGCAG

193

60

40

Mouse c-Myc

CAGAGGAGGAACGAGCTGAAGCGC

TTATGCACCAGAGTTTCGAAGCTGTTCG

228

66

40

Mouse Klf4

GTGCCCCGACTAACCGTTG

GTCGTTGAACTCCTCGGTCT

185

63

40

Human OCT4

AGCGAACCAGTATCGAGAAC

TTACAGAACCACACTCGGAC

142

55

40

Human SOX2

AGCTACAGCATGATGCAGGA

GGTCATGGAGTTGTACTGCA

126

55

40

Human c-MYC

ACTCTGAGGAGGAACAAGAA

TGGAGACGTGGCACCTCTT

159

52

40

Human KLF4

TCTCAAGGCACACCTGCGAA

TAGTGCCTGGTCAGTTCATC

105

58

40

Human GAPDH

ACAGTCAGCCGCA

GACAAGCTTCCCG

259

55

40

Supplemental materials and methods

Southern blot and Western blot analysis

To detect integration of the Sox2 and c-Myc (mouse) transgenes in the genome of iE cells, we conducted Southern blot using a non-radioactive method.1 Probes were synthesized by PCR amplification using DIG-dUTP labeling kit (Roche) and DNA template of retroviral vectors expressing mouse Sox2 or c-Myc cDNA transgene as previously described.2 Five or ten μg of genomic DNA was digested by BamHI (for c-Myc detection) and HindIII (for Sox2 detection), and then standard Southern blotting and chemiluminescence detection with CSPD were performed following the instruction manuals of DIG High Prime DNA Labeling and Detection Starter Kit II (Roche)1. Western blot for analyzing p53 protein level is carried out using a monoclonal antibody against P53 (Cat. P6874, Sigma) and loading control GAPDH (Cat. 5174, Cell Signaling Technology) according to the manufacturer’s instructions.
1. Zou J, Mali P, Huang X, Dowey SN, Cheng L. Site-specific gene correction of a point mutation in human iPS cells derived from an adult patient with sickle cell disease. Blood 2011; 118(17): 4599-608.
2. Maherali N, Sridharan R, Xie W, Utikal J, Eminli S, Arnold K et al. Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell 2007; 1(1): 55-70.




Share in:

Related:

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconSupplementary Figure Genes with high expression divergence between...

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconAbstract The purpose of this study was to determine whether a proprietary...

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconSupplementary Figure 1 – Over-expression of human hsj1a does not...

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconCrude Cell Pellets: 10 cell factories of gmp qualified hek293 cells...

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconCell lines and germinal center b cells

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconSupplementary Table Highly diverse stimuli induce chemokine expression in blood and tissue cells

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconThis machine can turning cylindrical surface, conical surface, spherical...

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconMonolithic Chip for High-throughput Blood Cell Depletion to Sort Rare Circulating Tumor Cells

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture icon9. The Regal Baking Company is considering the expansion of its business...

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconAbstract Circulating tumor cells (ctcs) enter peripheral blood from...

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconGemcitabine-Releasing Mesenchymal Stromal Cells inhibit in vitro...

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconEndogenous Retinal Progenitor Cell Regeneration and Reported Retinitis...

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconAbstract the name Surface comes from "surface computing,"

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconThe Meaning of Morphology

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconP/X-series Marker Review

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconKitiara, of all the days these days are locked in dark and waiting,...

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconRaspberry Pi Expansion Module

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconRaspberry Pi Expansion Module

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconPlayer Housing: a guide to the Construction Expansion

Figure cell surface marker expression and morphology of iE2 cells at additional days of expansion culture iconRna isolation and gene expression profiling




manual


When copying material provide a link © 2017
contacts
manual-guide.com
search