Supporting information for


Download 26.88 Kb.
NameSupporting information for
A typeDocumentation
manual-guide.com > manual > Documentation
Supporting information for

In vitro antibacterial activity of MGDG-palmitoyl from Oscillatoria acuminata NTAPC05 against extended- spectrum beta lactamase-producers

Abdul Azees Parveez Ahamed1, Mohammed Uddin Rasheed2, Kalilurrahuman Peer Muhamed Noorani3, Nazar Reehana1,4, Subramanian Santhoshkumar5, Mohamed Yousuff Mohamed Imran1, Naiyf S. Alharbi6, Chinnathambi Arunachalam6, Sulaiman Ali Alharbi 6,

Mohammad Abdulkader Akbarsha7and Nooruddin Thajuddin1,6,7
Running title: Inhibition of ESBL-producers by O. acuminata

1Division of Microbial Biodiversity and Bioenergy, Department of Microbiology, Bharathidasan University, Tiruchirappalli, India

2Centre for Biotechnology & Bioinformatics, Jawaharlal Nehru Institute of Advanced Studies, Secunderbad, India

3Department of Biomedical Science, Bharathidasan University, Tiruchirappalli, India

4 P.G. and Research Department of Microbiology, Jamal Mohamed College (Autonomous), Tiruchirappalli, India

5Department of Botany, Government Arts College (Autonomous), Karur, India

6Department of Botany and Microbiology, College of Science, King Saud University, Riyadh, Kingdom of Saudi Arabia

7National Centre for Alternatives to Animal Experiments, Bharathidasan University, Tiruchirappalli, India

Correspondence to: N. Thajuddin, Tel: 0431 2407082; Fax: 0431 2407045; Ph: 099423 79719 nthaju2002@yahoo.com

Materials and methods

16S rRNA gene amplification and sequencing

Genomic DNA was extracted from ESBL-positive bacterial strains (1). After extraction and purification, the DNA pellet was washed twice with 70% ethanol, dried, resuspended in MilliQ water and stored at –20 ºC until use. The extracted DNA was visualized on a 0.8% agarose gel stained with ethidium bromide and the purity was determined by UV-vis spectrophotometer (LABOMED, USA) at 260/280 nm. Universal 16S rRNA primers (2) (Table 2) were used for the amplification, and the PCR was performed with initial denaturation of 6 min at 94 ºC, followed by 35 cycles of denaturation for 30 s at 94 ºC, annealing for 45 s at 52 ºC, extension at 72 ºC for 45 s and final extension at 72 ºC for 7 m. The resulting PCR product was separated on 1.2% low melting agarose (Himedia, India), stained with ethidium bromide and recorded using a CCD camera in UVP gel documentation system (UVP, England). A standard molecular weight marker of 1 kb ladder was used as marker DNA. Amplicons were purified using a QIA quick PCR purification kit (Qiagen GmBh, Germany) as prescribed in the manufacturer’s protocol. The sequences of the PCR products were determined by using the Big Dye Terminator Cycle Sequencing v2.0 kit in an ABI310 automatic DNA sequencer (Applied Biosystems, CA, USA).

Results

All three ESBL-producers were identified based on 16S rRNA gene sequencing which is approximately in 1353bp. Universal 16S rRNA nucleotide sequences were assigned GenBank accession no. as follows: KC759521, KC759523 and KC759524 for E. coli U655, S. maltophilia B929 and E. asburiae B938, respectively.
References

  1. Sambrook J, Russel DW. 2001. Extraction and purification of plasmid; screening of bacterial colonies by hybridization. In: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press: New York, USA. 1: 31-180.

  2. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 1991. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol. 173: 697- 03




Primers

Nucleotide Sequences

References

UB16S-F

UB16S-R

AGAGTTTGATCCTGGCTCAG

ACGGCTACCTTGTTA CGACT

Weisburg, et al17


Table 2. Oligonucleotide primers used for 16S rRNA gene amplification in ESBL-positive isolates

Supplementary results
Supplementary Figures

S1. Phylogenetic analysis of marine cyanobacterium O. acuminata NTAPC05 using MEGA 5.0

S2. Thin layer chromatography analysis of O. acuminata NTAPC05 methanol extract

S3. Fractionation of O. acuminata crude methanol extract by preparative HPLC

S4 Antibacterial activity of O. acuminata fractions against ESBL-producers

S5. HPLC analysis of purified active fraction from O. acuminata NTAPC05

S6. FTIR spectrum of active fraction from O. acuminata NTAPC05

S7 (a) 1H NMR analysis of active fraction from O. acuminata NTAPC05

(b) 13C NMR spectrum of active fraction from O. acuminata NTAPC05

S8 Iodometric assay for beta-lactamase inhibition of ESBL- E. coli using ampicillin and MGDG- Palmitoyl from O. acuminata NTAPC05 alone in the starch agar plates.


Fig. S1 Phylogenetic analysis of marine cyanobacterium O. acuminata NTAPC05, using MEGA 5.0


Table S2 Thin layer chromatography analysis of O. acuminata NTAPC05 methanol extract

Spot1- hexane / ethyl acetate (2:8) ratio

Spot2- hexane / ethyl acetate (3:7) ratio

Spot3- methanol / chloroform (1:9) ratio

Spot4- methanol / chloroform (3:7) ratio



Fig. S3 Fractionation of O. acuminata crude methanol extract by preparative HPLC

F1- Fraction (1) collected with retention time 2.077; F2- Fraction (2) collected with retention time 2.809; F3- Fraction (3) collected with retention time- 4.802; F4- Fraction (4) collected with retention time- 12.619


Fig. S4 Antibacterial activity of O. acuminata fractions against ESBL-producers

F1- (No zone); F2- (14 mm of zone of inhibition); F3- (8 mm of zone of inhibition) and F4- (No zone) are the fractions of O. acuminata methanol extract, Compared drug Cefepime- No zone; DMSO (Dimethyl sulfoxide)- Negative control.



Fig. S5 HPLC analysis of purified active fraction from O. acuminata NTAPC05

The homogeneity of active fraction (2) confirmed with retention time 2.809


Fig. S6. FTIR spectrum of active fraction from O. acuminata NTAPC05



Fig. S7 (a) 1H NMR analysis of active fraction from O. acuminata NTAPC05

Fig. S7 (b) 13C NMR spectrum of active fraction from O. acuminata NTAPC05


A

B


Fig. S8 Iodometric assay for beta lactamase inhibition of ESBL-E. coli using ampicillin and MGDG-palmitoyl from O. acuminata NTAPC05 alone in the starch agar plates.

A-ampicillin (150 µg/mL) alone tested against ESBL-E.coli; no inhibition was observed, B- Inhibition was observed for MGGD- palmitoyl at sub MIC (50 µg/mL) concentration.

Share in:

Related:

Supporting information for iconSupporting Information

Supporting information for iconSupporting Information

Supporting information for iconSupporting information

Supporting information for iconSupporting Information Tables S1 and S2

Supporting information for iconSupporting Information Materials and methods

Supporting information for iconSupporting Information-Materials and Methods

Supporting information for iconSupporting Information for Fontanez and Cavanaugh

Supporting information for iconSupporting Information for Wojtovich et al. “Slo-2 is Cytoprotective...

Supporting information for iconSupporting Information for “ Getting Started in Gene Expression Microarray...

Supporting information for iconTechnical writer supporting clients in the aerospace, telecommunications,...

Supporting information for iconSupporting Information for ‘Postponing emission reductions from 2020...

Supporting information for iconSupporting Naval Research Lab Code 1220 ia group (v-tech Solutions)...

Supporting information for iconSupporting file legends: Supporting file: iRocs supportingMethods pdf

Supporting information for iconSupporting experimental procedures

Supporting information for iconSchedules and supporting documents to RegulatoryC

Supporting information for iconAdditional Resources Supporting Documents

Supporting information for iconSupporting Colorado Motor Vehicle Enthusiasts since 1965

Supporting information for iconSchedule­ 13 Supporting Fat Loss With Proper Nutrition 15

Supporting information for iconSection 2 – Property Inspections including Supporting Documents

Supporting information for iconTamron announces the launch of a vari-focal lens supporting mega-pixel resolution and nir




manual


When copying material provide a link © 2017
contacts
manual-guide.com
search