Supplementary Materials and Methods




Download 9.97 Kb.
NameSupplementary Materials and Methods
A typeDocumentation
manual-guide.com > manual > Documentation

Supplementary Materials and Methods




Northern blot analysis: Northern blot analysis was used to characterize the mRNA levels of key inflammatory mediators involved in endotoxic shock. RNA was extracted from spleen, lung, kidney, liver and heart of each mouse (from different treatment groups) using Trizol® (Invitrogen, Carlsbad, CA) and subjected to Northern blot analysis in a manner similar to that described previously [19, 30]. Probes were as follows: The GAPDH cDNA was from Clontech (Palo Alto, CA). mTNF was excised from pORF9-mTNF (Invivogen, San Diego, CA). Other probe sequences were synthesized by RT-PCR [30] using the following cDNA specific primers: mouse IP-10, forward: CCATCAGCACCATGAACCCAAGTCCTGCCG, backward: GGACGTCCTCCTCATCGTCGACTACACTGG; mouse IL-1, forward: CTCATCTGGGATCCTCTCCAGCCAAGCTTC, backward: CCATGGTTTCTTGTGACCCTGAGCGACCTG; mouse IL-6, forward: CCAGTTGCCTTCTTGGGACTGATGCTGGTG, backward: GTCCTTAGCCACTCCTTCTGTGACTCCAGC; MCP-1, forward: CTCACCTGCTGCTACTCATTC, backward: GCTTGAGGTGGTTGTGGAAAA. The IRF-1 probe was prepared as described previously [30].



Standard reverse transcriptase PCR: The procedure followed was similar to that described earlier [21]. Primer sequences were as follows: mCOX-1, forward: CCCAGAGTCATGAGTCGAAGGAG, backward: CAGGCGCATGAGTACTTCTCGG; mCOX-2, forward: GCAAATCCTTGCTGTTCCAATC, backward: GCAGAAGGCTTCCCAGCTTTTG; iNOS, forward: CCCTTCCGAAGTTTCTGGCGACAGCGGC, backward: GGCTGTCAGAGCCTCGTGGCTTTGG.
Immunohistochemistry: Immunohistochemistry was used to characterize VCAM-1 and ICAM-1 protein expression in a manner similar to that described previously [21]. The reagents utilized included goat mAb to mouse VCAM-1 (R&D System; Minneapolis, MN) or mouse ICAM-1 (R&D System) and biotinylated anti-goat secondary antibody (Goat Extravadiin Staining Kit, Sigma). Sections were photographed using a Nikon Eclipse E600 microscope (Nikon, Japan) equipped with a digital camera (DC Imaging, West Chester, OH) (original magnifications: x100, x200 and x400).
Histological analyses: Tissue samples from lungs and liver were fixed in 4% formalin, dehydrated in serial alcohol, cleared in chloroform and embedded in paraffin. Tissue sections (5 µm thickness) were mounted onto Vectabond (Vector Laboratories, Burlingame, CA) pre-treated slides and, subsequently, cleared and re-hydrated. Sections were stained with Protocol™: Progressive Hematoxylin and Eosin Manual Staining (Fisher Diagnostics, Middletown, VA). The sections were subsequently photographed as described above.
Immunoblot analysis: Lungs and kidneys of each mouse (from different treatment groups) were homogenized in PBS and, subsequently, lysed using lysis buffer (150 mM NaCl, 1% IGE-PAL CA 630, and 50 mM Tris-HCl, pH 8.0) supplemented with protease inhibitor cocktail (PMSF, leupeptin, and pepstatin A). Immunoblot analysis was performed as described previously (REF). The reagents utilized included: rabbit anti-human phospho Stat1 (Tyr 701) antibody (9171; Cell Signaling Technology, Beverly, MA), HRP-conjugated goat anti-rabbit Ab (sc-2054; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and rabbit anti-human Stat-1 p84/p91 (E-23)X antibody (sc-346X; Santa Cruz Biotechnology, Inc.).
RAW 264.7 cell culture and treatment: RAW 264.7 mouse macrophage cell line was purchased from ATCC (Manassas, VA) and cultured in Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen, Carlsbad, California) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Hyclone, Logan, UT). For experiments, cells were grown to 100% confluence and treated with 1 g/ml LPS in the absence or presence of varying concentrations of C10 dissolved in DMSO.
Nuclear extracts and EMSA: The procedure followed was as described earlier [19]. Nuclear extracts were prepared from harvested RAW 264.7 cells using NE-PER® extraction reagents (Pierce Chemical Co.; Rockford, IL) in the presence of a protease inhibitor cocktail (PMSF, leupeptin, pepstatin-A). Oligo nucleotide probe sequences (Biosynthesis Inc.; Lewisville, TX) were as follows: NF-B, sense strand: 5'-GCAGGGACTTTCCACAA-3'; IRF-1, sense strand: 5'-GACATAGGAAAACTGAAAGGGAGAAGTGAAAGTGGGAA-3'. For supershift studies, the antibodies against IRF-1, p50, p65, c-rel and rel-B were all from Santa Cruz Biotechnology (Santa Cruz, CA) and antibody against IRF-3 was from Active Motif (Carlsbad, CA).
Densitometric analysis: For northern blots and EMSAs, the images were captured using a BAS 1500 Bioimaging Analyzer (Fuji Photo Film Medical Systems USA, Stamford, CT). For western blot analyses, the images were captured using a Biomax-MR film (Kodak). For RT-PCR, images (from ethidium bromide stained gels) were captured using a Kodak camera. Subsequently, scanned images were imported into Adobe Photoshop (Adobe Systems, Mountain View, CA). To quantify the relative differences in intensities of various bands, densitometry analysis was performed using the Kodak Image Station software with high-resolution “jpeg” images. For each image, the optical densities of various bands were determined keeping the area and the pixel number constant. For RT-PCR studies, data were normalized with respect to GAPDH control. For western blot analyses, data were normalized with respect to total STAT-1 levels. For mouse-related studies, the normalized intensity of bands from samples from naive mice was fixed as 1. For in vitro studies, the intensity of bands from unstimulated RAW264.7 mouse macrophages was fixed as 1.





Share in:

Related:

Supplementary Materials and Methods iconSupplementary Materials and Methods and Supplementary Tables

Supplementary Materials and Methods iconSupplementary materials and methods

Supplementary Materials and Methods iconSupplementary Materials and Methods

Supplementary Materials and Methods iconSupplementary Materials and Methods

Supplementary Materials and Methods iconSupplementary Materials and Methods

Supplementary Materials and Methods iconSupplementary Materials and Methods

Supplementary Materials and Methods iconSupplementary Materials and methods

Supplementary Materials and Methods iconAdditional File 3 Supplementary Materials and Methods

Supplementary Materials and Methods iconSupplementary Materials and Methods, Tables, and Figure Legends

Supplementary Materials and Methods iconSupplementary Methods

Supplementary Materials and Methods iconSupplementary Methods

Supplementary Materials and Methods iconSupplementary Methods

Supplementary Materials and Methods iconSupplementary Methods

Supplementary Materials and Methods iconSupplementary 1: Material and methods

Supplementary Materials and Methods iconSupplementary information – Methods

Supplementary Materials and Methods iconText S1: Supplementary materials

Supplementary Materials and Methods iconRiba, et al. Supplementary Materials

Supplementary Materials and Methods iconDetailed materials and methods

Supplementary Materials and Methods iconSupporting Information Materials and methods

Supplementary Materials and Methods iconSupporting Information-Materials and Methods




manual




When copying material provide a link © 2017
contacts
manual-guide.com
search