Supplementary Materials and Methods


Download 20.41 Kb.
NameSupplementary Materials and Methods
A typeDocumentation
manual-guide.com > manual > Documentation
Supplementary Materials and Methods
Human Endometrial Tissue

All human tissue samples were obtained from patients under protocols approved by Institutional Review Boards at the University of Texas Health Science Center and MD Anderson Cancer Center.

Gene expression was analyzed in fresh frozen tissues from 71 endometrioid adenocarcinoma samples obtained at the time of hysterectomy and submitted to the Department of Pathology, MD Anderson Cancer Center. Diagnoses were confirmed following light microscopic examination of H&E-stained slides by a gynecologic pathologist at MD Anderson Cancer Center (Houston, TX). Tissues were frozen in liquid nitrogen and stored at -80 C.

Gene expression was analyzed in postmenopausal endometrial tissues obtained from a selected subset (n = 11) of a large group of healthy postmenopausal women (n = 210) participating in a clinical trial of estrogen replacement therapy (ERT) as described previously(Deng et al., 2005). Tissues were frozen in liquid nitrogen and stored at -80 C.

DNA methylation analysis was conducted on normal tissues derived from baseline endometrial biopsies from an endometrial cancer chemoprevention trial as previously described (Xie et al., 2007). Endometrial pipelle biopsies (n=10) were obtained under conditions approved by the institutional review board at the University of Texas M.D. Anderson Cancer Center. Tissues were frozen in liquid nitrogen and stored at -80 C. DNA methylation status was also analyzed in endometrial cancer cells which were manually dissected from adjacent stroma in paraffin-embedded tumor sections using a 2.0 mm biopsy punch (Fray Products Corp.).
RNA extraction
Frozen tissues were homogenized in TriReagent® (Molecular Research Center) and RNA was precipitated with isopropanol, applied to RNeasy spin columns (Qiagen), eluted, and treated with RNase-free DNase for 30 min at 37 C, followed by heat inactivation at 75 C and storage at -80ºC.
Quantitative Real Time-RT PCR (QPCR)

QPCR was performed utilizing the 7700 Sequence Detector (Applied Biosystems) as previously described (Xie et al., 2007). Taqman real-time quantitative assays for survivin and 18S rRNA were developed using Primer Express software (Applied Biosystems) based on sequences from GenBank. The assays were developed and all QPCR reactions were completed at the Quantitative Genomics Core Laboratory (UT-Houston Medical School, Houston, TX, USA). The primer and probe sequences and accession number for the survivin assay are: 181+CCACTGCCCCACTGAGAAC, 255-GGCTCCCAGCCTTCCAG, 204+FAM-CAGACTTGGCCCAGTGTTTCTTCTGCT-BHQ, NM_001168. The 18s rRNA assay details have been previously published (Xie et al., 2007). The final transcript values were normalized to those determined for 18S rRNA and are presented as molecules of transcript/molecules of 18S rRNA.

Cell culture

Ishikawa endometrial cancer cells (ATCC) were maintained in RPMI1640 medium (Gibco) supplemented with 10% FBS, 1U/mL penicillin/ 1ug/mL streptomycin, and 10mM Hepes. HCT116wt and HCT116 p53-/- colon cancer cells (a generous gift from Dr. Bert Vogelstein) were maintained in McCoy’s 5a growth medium (Gibco) supplemented with 10% FBS and 1U/mL penicillin/ 1µG/mL streptomycin. All cells were maintained in a humidified 37ºC incubator with 5% CO2.

DNA isolation

DNA was isolated according to TriReagent® protocol by phenol and chloroform separation, ethanol precipitation, and solubilization in 8mM NaOH. HEPES was used to adjust the pH to 8.4 prior to bisulfite treatment.

Bisulfite Treatment of DNA
Bisulfite modification of 2µg of DNA was performed by using the EZ DNA Methylation-Gold Kit™ (Zymo Research Corp.) according to manufacturer protocol
Methylation Analysis
Metylation specific PCR (MSP) was conducted on bisulfite treated DNA from 5 normal endometrial tissue and 15 endometrioid adenocarcinomas. Each sample was PCR amplified in parallel in a 10µL reaction volume under the following conditions: 1X PCR buffer (16.6 mM ammonium sulfate, 67 mM Tris-HCL pH 8.8, 6.7 mM MgCl2, 10 mM -mercaptoethanol), 0.5mM dNTPs, 200nM specific methylated or unmethylated PCR primer pairs and 0.5U HotStart Taq DNA polymerase (Qiagen). Thermocycler condition were: 15min. at 95ºC, 35 cycles of 30sec. at 95ºC, 30sec. at 55ºC and 30sec. at 72ºC followed by a final extension step of 10min. at 72ºC. PCR product was subject to gel electrophoresis on a 6% 0.5X TAE polyacrylamide gel and visualized by ethidium bromide staining. Results were validated by bisulfite Pyrosequencing™. PCR reactions were carried in 50 µl reaction volume including 2 µl bisulfite treated DNA, 16 mM (NH4)2SO4,67 mM Tris-HCl (pH 8.8), 1 mM 2-mercaptoethanol 2 mM MgCl2, 0.125 mM dNTP, 1 unit Taq polymerase, and 200 nM primers. Results were quantitated using the PSQ HS 96Pyrosequencing System (Pyrosequencing Inc) at the UCLA Sequencing Core in the Department of Human Genetics. Three of the samples were spiked with 100%, 25% and 10% in vitro methylated DNA to monitor the efficiency of the pyrosequencing reaction. The assay is biased against methylation such that the measured percentages for the 100%, 25% and 10% methylated samples were 32%, 6% and 3% respectively. We conducted linear regression analysis and generated a standard curve with a 99% correlation coefficient to correct for this assay bias.
Sss1 in vitro Methylation
DNA samples were methylated in vitro using the CpG Methylase M.SssI (New England Biolabs) according to manufacturer protocol.
Gel-shift assay
Single stranded oligonucleotide probes were duplexed, methylated, then labeled with the Biotin 3' End DNA Labeling kit (Pierce Biotechnology) according to manufacturer’s protocol. Binding reactions (RT, 20 min) contained 20ng purified p53 protein (Active Motif), buffer (10 mM Tris pH 7.5, 50 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 0.05% TX-100, 2.5% glycerol), 1 µg poly(dI-dC), and 2 nM of biotinylated survivin probe (5'- 3':senseGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCG anti-sense-TGGCGCGCCGCGGGGCATGTC GGGAGCGCACGCCCTCTTA). The probe is designed such that duplex will contain 3nt overhangs on the 3’ ends. Biotinylation efficiency was estimated by dot blot analyses against control oligonucleotides. Protein-DNA complexes were resolved on 5% Tris borate-EDTA gels, transferred to nylon membranes, and visualized utilizing the Chemiluminescent Nucleic Acid Detection Module (Pierce Biotechnology) according to manufacturer’s protocol. Some reactions were preincubated for 10 min with 200-fold excess of unlabeled probe and/or an anti-p53 antibody (Active Motif) before adding biotinylated probe.

For the E2F1 gel shift, HCT116 p53-/- cells were transfected with a CMV-E2F1 overexpression vector (Addgene plasmid 10736- 408 pSG5L HA E2F1) and nuclear lysates were prepared with NE-PER nuclear and cytoplasmic extraction kit (Pierce). Probes were then incubated with 5µg nuclear lystae and analyzed as described above. Some reactions were preincubated for 10 min with 200-fold excess of unlabeled survivin probe or anti-E2F1 antibody (Santa Cruz) before adding biotinylated survivin.
Drug treatment
Cells were grown to 60% confluency then treated with 0.5µM, 1µM or 2µM doxorubicin (Sigma) for 48hrs.

Cells treated with decitabine (5-Aza-2-deoxycytidine) were seeded to 20% confluency then maintained in 2µM decitabine (Sigma) for 4 days. Media was changed daily with fresh drug application.
Western Blot
Cells were lysed by incubation for 1 hour at 4°C in 100 µL Triton lysis buffer [1% Triton X-100, 150 mmol/L NaCl, 25 mmol/L Tris (pH 7.5), 1 mmol/L glycerol phosphate, 1 mmol/L sodium fluoride, and 1X Complete Mini Protease Inhibitor Cocktail (Roche Applied Science, Indianapolis, IN)]. Lysates were centrifuged for 10 minutes at 14,000 x g at 4°C. Supernatants were saved and boiled for 5 minutes with SDS-PAGE sample buffer (50 mmol/L Tris-HCL, 2% SDS, 0.1% bromophenol blue, 10% glycerol, and 5% ß-mercaptoethanol). Samples then resolved by SDS-PAGE, and electrophoretically transferred to nitrocellulose membranes. Membranes were incubated overnight at 4°C with primary antibodies specific for survivin (Cell Signaling Technology), p53 (Calbiochem) and B-actin (Millipore). Membranes were incubated with species-specific secondary antibodies then visualized by chemiluminescence.
Microarray Analysis Using BeadChip Arrays



Microarray experiments were done on two independent RNA samples from HCT116 cells. RNA was isolated as described above and microarray analysis was conducted using HumanRef-8 BeadChip arrays from Illumina. RNA was amplified and hybridized according to the manufacturer’s protocol. Following scanning, Bead Studio 3 (Illumina) was used for data analysis.
Statistical Analysis
Statistical differences for QPCR analysis were calculated by Kruskal-Wallis non-parametric one-way ANOVA followed by Dunn’s multiple comparisons post test. Differences for pyrosequencing analysis were calculated by two-tailed Mann-Whitney non-parametric t-test. Differences for QPCR microarray validation analysis were calculated by unpaired t-test. Differences were considered significant if p<0.05. For microarray analysis, after background subtraction arrays were normalized to each other by quantile normalization.  Changes in gene expression were tested using a modified t-test that employs estimates of variation that include sequence specific biological variation (sbio), nonspecific biological variation (sneg) and technical error (stech) ( Illumina User Guide, rev B. page 6-11 – 6-12, 2005, Illumina Inc) . Genes were considered differentially regulated at p<0.001.




Share in:

Related:

Supplementary Materials and Methods iconSupplementary Materials and Methods and Supplementary Tables

Supplementary Materials and Methods iconSupplementary Materials and Methods

Supplementary Materials and Methods iconSupplementary Materials and Methods

Supplementary Materials and Methods iconSupplementary materials and methods

Supplementary Materials and Methods iconSupplementary Materials and methods

Supplementary Materials and Methods iconSupplementary Materials and Methods

Supplementary Materials and Methods iconAdditional File 3 Supplementary Materials and Methods

Supplementary Materials and Methods iconSupplementary Materials and Methods, Tables, and Figure Legends

Supplementary Materials and Methods iconSupplementary Methods

Supplementary Materials and Methods iconSupplementary Methods

Supplementary Materials and Methods iconSupplementary Methods

Supplementary Materials and Methods iconSupplementary Methods

Supplementary Materials and Methods iconSupplementary 1: Material and methods

Supplementary Materials and Methods iconSupplementary information – Methods

Supplementary Materials and Methods iconRiba, et al. Supplementary Materials

Supplementary Materials and Methods iconText S1: Supplementary materials

Supplementary Materials and Methods iconDetailed materials and methods

Supplementary Materials and Methods iconSupporting Information Materials and methods

Supplementary Materials and Methods iconMaterials and methods. Sequence analyses

Supplementary Materials and Methods iconBasic concrete materials and methods




manual


When copying material provide a link © 2017
contacts
manual-guide.com
search